UU | BMC | Bioorg. Chem. | Research | Teaching | Information | People | Local Info

Department of Bioorganic Chemistry

Oligonucleotides against Huntington's desease

Our chemically modified antisense oligos (AON) and short interfering RNAs (siRNA) have demonstrated four important characteristics to block gene expression by cleaving the target mRNA: (1) blood-serum stability, (2) conformational pre-organization enhancing the target RNA affinity, (3) in case of AONs the RNase recruitment capability is as good as the native and (4) effective down regulation against cognate RNA as AON or as siRNA agents. Thus, our novel conformationally-constrained novel carba-LNA/ENA nucleotides molecules incorporated into AONs and siRNAs have been able to show successful gene down-regulation through inhibition of the cognate RNA (of Huntingtin gene responsible for Huntington’s disease (IC50 17 nM) and as siRNAs agents against HIV/AIDS, (IC50 1.7 nM and 0.38 nM against TAR1 and Nef2, respectively). The main remaining challenge is tissue-specific delivery of the proposed potentially therapeutic oligos. Intelligent chemical modification leading to effective AON/siRNA is aimed for to improve the cellular uptake, high in vitro/in vivo efficacy, high RNA affinity and favorable pharmacokinetics and limiting of the off-target effects while retaining enhanced nuclease stability inside the cell. Our AON/siRNA will down-regulate specific mRNA in order to be used as therapeutics by exploiting the intrinsic catalytic mechanism provided by the RNase H for AON and RISC for siRNA, which will in turn optimize the dose-dependent pharmacokinetic and pharmacological effects in humans (see PDF 402  [K. Gagnon, H. Pendergraff, G. Deleavey, E. Swayze, P. Potier, J. Randolph, E. Roesch, J. Chattopadhyaya, M. Damha, F. C. Bennett, C. Montailler, M. Lemaitre and D. Corey. Biochemistry, 9(47), 10166-10178 (2010) ]).

We have performed studies aiming at the specific knock-off of the cognate RNA of Huntingtin gene responsible for Huntington’s disease (collaboration with Prof David Corey/USA) as well as at the Design & Synthesis of Modified siRNAs against HIV/AIDS (collaboration with Prof S. Datta/IMM/Pune). A short account of results of these preliminary studies is given in Appendix A. From the results of preliminary investigation on siRNA approach to HIV-1 gene-silencing we have identifies two credible targets - TAR1 and Nef2 sites - for RNA interference by the modified siRNAs (see Table 1 for the sequence and the site of antisense strand modifications with carba-LNA and LNA against TAR1 and Nef2 cognate RNA).

Table 1: Sequence and the site of antisense strand modifications with carba-LNA and LNA against TAR1 and Nef 2 cognate RNA of HIV. (Modification site is shown in bold/underscored)

Antisense strand Sequence

in siRNA for TAR1 of HIV

Codes & IC50 for carba-LNA-T

Codes & IC50 for LNA-T

TAR1 site

5'-U1AG CCAGAGAGCT13CCCAGGUU21-3’

G23 (IC50 = 7.7 nM)

G82 (IC50 = 10.5 nM)

5'-T1AGCCAGAGAGC T13CCCAGGUU21 -3’

G24 (IC50 = 17.5 nM)

G83 (IC50 = 35.5 nM)

5'-T1AGCCAGAGAGCUCCCAGGUU21-3’

G25 (IC50 = 4.9 nM)

G84 (IC50 = 27.2 nM)

5'-U1AGCCAGAGAGCUCC15CAGGT20U21-3’

G89 (IC50 = 8.1 nM)

Not done yet

Nef2 site

5'-U1GUGCUUCT9AGCCAGGCACUU-3’

G34 (IC50 = 0.7 nM)

G93 (IC50 = 10.5 nM)

5'-U1GT3GCUUCT9AGCCAGGCACUU-3’

G35 (IC50 = 18.1 nM)

G94 (IC50 = 35.5 nM)

5'-U1GT3GCT6UCUAGCCAGGCACUU-3’

G37 (IC50 = 91.7 nM)

G96 (IC50 = 27.2 nM)

5'-U1GUGCUUCUAGCCAGGCACT20U-3’

G104 (IC50 = 0.14 nM)

Not done yet


Full report on allele-selective inhibition of mutant huntingtin expression with antisense oligonucleotides targeting the expanded CAG repeat has been resently published in Ref 402  [K. Gagnon, H. Pendergraff, G. Deleavey, E. Swayze, P. Potier, J. Randolph, E. Roesch, J. Chattopadhyaya, M. Damha, F. C. Bennett, C. Montailler, M. Lemaitre and D. Corey. Biochemistry, 9(47), 10166-10178 (2010) ]